Pathway- Inustry, manufacturing, construction, & Transportstion(IMC)

Part 1 Generate a table with 2 columns; one for TRANSCRIPTION and one for TRANSLATION. Under each column, you should have 3 rows: DEFINITION, LOCATION, STEPS. Fill out the table and when listing the STEPS for both transcription and translation, make sure to list 2 events under each. Make sure to list the functions of mRNA, tRNA and rRNA within the description of the STEPS for TRANSLATION Part 2: Using the codon table below, convert the following strand of DNA into a polypeptide strand. 5′ – GGGCATTACACGTTACCCCAAATTGGA 3′ Please show both the transcription and translation steps. Cleary indicate the START codon and STOP codon. Write down the final amino-acid sequence generated by this DNA strand. Part 3: Explain the differences in management roles between mRNA, rRNA and tRNA. What are their specific duties and responsibilities within translation, make sure to mention within which step(s) each RNA molecule is most effective. Which RNA plays the most essential role in transportation during translation? This assignment is to be completed through the use of Microsoft excel and/or word, with a 2 page limit.

Are you looking for a similar paper or any other quality academic essay? Then look no further. Our research paper writing service is what you require. Our team of experienced writers is on standby to deliver to you an original paper as per your specified instructions with zero plagiarism guaranteed. This is the perfect way you can prepare your own unique academic paper and score the grades you deserve.

Use the order calculator below and get started! Contact our live support team for any assistance or inquiry.

[order_calculator]