Author: best-essay

In the first section, titled Early Years, you are to write about the significance of 3 decisions Tony made during his early life through high school and how those decisions and the consequences of those decisions shaped his future as an entrepreneur.In the second section, titled College through Pre-Zappos, you are to again write about the significance of 3 decisions Tony made during that time of his life and how those decisions and the consequences of those decisions shaped his future.In the third section, titled Zappos: Part I, you are to write about the significance of 3 decisions
Tony made while getting Zappos off the ground and what other business leaders can learn from those 3 decisions and the consequences of those decisions.

Write a research paper on the novel Beloved by Toni Morrison, analyzing its plot and literary devices.

2. Describe, and critically evaluate, both theoretically and in practice, different regional models of corporate law & governance;
3. Operate professionally, ethically and with cultural awareness in a global corporate context.
Practical, Professional or Subject Specific Skills4. Advise on legal and regulatory matters
5. Produce a report on legal issues for a business client
Transferable/Key Skills and other Attributes.6. Work in teams to clarify objectives, exchange ideas and knowledge and evaluate the contributions of others in constructing cogent and persuasive arguments in response to the issues and problems posed;
7. Locate and synthesise information from a range of published literature and electronic sources and present this effectively in oral, written and other media;
Take responsibility for their personal learning and continuous professional development Case Study: Memorandum of Instructions From: Jane Ball (Corporate Partner)To: Ellen Collini (Associate)Date: 3rd April 2018 Westlands Group PLC As you know, one of our most important corporate clients is Westlands Investments PLC (Westlands), a long established engineering company which is quoted on the FTSE 350 on the London Stock Exchange. This morning I met with Ralph Warner, Thomas Richardson and Pranav Choudhury, respectively the Chairman, CEO and finance director of Westlands to take instructions on some extremely important issues that they are currently dealing with. They want us to prepare a detailed report for them on these issues, and have given us a strict deadline to submit the completed report so that it can be considered by the full board of directors in two weeks time. I shall require your assistance in compiling the report as I am currently committed to dealing with a number of other important matters. The issues they wish us to advise on are as follows: The Board have been concerned for a couple of years about the stagnating company profits and the rising costs associated with the business. These concerns have been exacerbated since the fall in the value of the pound following the Brexit vote, as they rely upon imported raw materials and the cost of these has increased massively over the last 18 months. At present, all of their production takes place in the UK, but they are now seriously considering closing their factory in Preston, Lancashire and moving production to a new plant in Romania. They have carried out detailed modelling which suggests that this would reduce costs by around 15%, helping improve the companys profitability. However, such a move would result in their current workforce of 1,500 in Preston losing their jobs, and there is certain to be great resistance to the move from workers and from both local and central government. They also know that there is a significant minority of shareholders who would oppose the move, having invested in the company due to its commitment to maintaining production in the UK. They are concerned that these shareholders may try to bring court action to prevent the board making a decision to move production outside of the UK, and would like to know what shareholder action may be possible and what steps the board should take to protect against the risk of such action.
The Board has also been thinking about the remuneration payable to board members and other senior executives within the company. They are concerned that they may lose highly valued staff, including possibly some Board members, as competitors generally pay more to senior staff than Westlands do. Keeping executive remuneration relatively low has always been the companys philosophy, one which the shareholders are very happy with, but the Board now feel this is no longer sustainable. They would like to know what controls are imposed on executive pay by legislation and the Corporate Governance Code, plus need advice on what powers the shareholders have to oppose and perhaps block any proposed increases.
Finally, the Board would like some advice on the role and number of executive and non-executive directors that they should have, and the extent to which any non-executive directors need to be independent.

Create a podcast series with a written copy that includes the following information:Detailed description of the podcast including why your group chose the topic and the audience for the series. Introduction for the podcast Closing for the podcast including what the listener can expect in the next episode.Provide a synopsis for 1 Episode describe it in detail (What will be discussed? Who are the guests?)First Episode Be prepared to present to the class your podcast AND the first episode of the podcast. Try out your approach and what youve written. Make it engaging. Be creative and have fun.

Clearly explain what utilitarianism is, and then discuss the general worries regarding justice, fairness and/or integrity, using specific examples. Then evaluate whether these arguments are convincing, and whether or not a utilitarian can possibly give a response.

2.Given current trends in risk factors, what re likely to be the major cause of death and disability in low- and middle-income countries in the 2020s and beyond? Which policies and actions taken over the next decade at national and international levels could influence these trends, and which factors might facilitate their implementation.3.What are the characteristics of particular environmental health problems that render them more, or less, tractable to amelioration or elimination?4.As the scale of human impact on the global “environment” increase, people become more concerned about the consequences of disruption of our “habitat.” What does this signify?

Do you have any suggestions for improvement?2.A growing number of American women what to give birth at home instead of at a hospital. What do you think about this practice? What environment would you prefer if you were giving birth or your partner was giving birth?3.Do you think that there is a limit to the number of humans who can live on Earth? What factors contribute to the ability of the Earth to sustain (or fail to sustain) a large number of humans?

Your target audience was not present at the time of your experience so it is your job to create a vivid image for them. Help them see what you saw and feel what you felt. Use descriptive words that evoke sensory experiences. Include in your description references to each of the five senses. You will also want to include signal words to explain where things or people are in relation to you and to other things and people? Employ the writing process techniques we have discussed thus far. Create a mind map to help you think through all of the different ideas you would like to incorporate into your description. Write a draft and revise it using a thesaurus to help you make the most effective word choices. This assignment is meant to help you practice writing descriptively and making effective word choices. You will not be graded on grammar, structure, or organization though you may receive feedback about how each of these components impacts your description.

Format of the Project: The Data Exercise must be posted to the LEO Student Assignments as a Attachments are limited to a maximum two files in doc, docx., xls. xlsx., or rtf. formats. OTHER FORMATS ARE NOT ACCEPTABLE, will not be reviewed or graded. Please note that hand-written and scanned works, pdf. files, jpg. files, as well as files posted in google drive, will not be accepted or graded. The paper should be written in APA style Research Paper format. Please note that Use of APA Citation Methodology is required for all parts of the assignment Written projects must be: typed, double-spaced, in 12-point Times New Roman or Arial font, with margins no wider than one inch have footnotes or endnotes, with correct citations have a bibliography of sources used include, for each entry, the author, title, city and state of publisher, publisher’s name, year, and page numbers prepared using word processing software (Microsoft Word preferred), in a manner similar to the preparation of a written assignment for classroom submission DATA EXERCISE #2 Consists of three parts Part 1: The Unemployment Rate (weight 30% of the assignment grade) Complete the following exercise Visit the Bureau of Labor Statistics Web Site, www.bls.gov/news.release/empsit.toc.htm (https://www.bls.gov/news.release/empsit.toc.htm). Select Employment Situation Summary. Write a report (1 – 2 pages double spaced) to answer the questions: What month (and year) is summarized? What was the unemployment rate for that month? How does that rate compare with the rate in the previous month? What were the unemployment rates for adult women, teenagers, blacks, Hispanics, and whites? How did these rates compare with those a month earlier? What factors make it difficult to determine the unemployment rate? Why is unemployment an economic problem? What are the noneconomic effects of unemployment? Who loses from unemployment? Please analyze and discuss the significance of the data that you received for this Data exercise. Reflect on what you have learned from this exercise. Part 2: The Inflation Rate (weight 30% of the assignment grade) Complete the following exercise: Visit the Bureau of Labor Statistics Web Site, www.bls.gov/news.release/cpi.toc.htm (https://www.bls.gov/news.release/cpi.toc.htm). Select Consumer Price Index Summary. Write a report (1 – 2 pages double spaced) to answer the questions: What month (and year) is summarized? What was CPIU for that month? What was the rate of inflation (percentage change in the CPIU) for the month? How does that rate of inflation compare with the rate in the previous month? Which two categories of goods or services had the greatest price increase for the month? Which two categories of goods or services had the lowest price increase (or greatest price decrease) for the month? Who loses from inflation? Please analyze and discuss the significance of the data that you received for this Data exercise. Reflect on what you have learned from this exercise. Part 3: Unemployment Data by Labor Force Groups and Duration (40% of the project grade) Go to HYPERLINK “https://www.gpo.gov/fdsys/browse/collection.action?collectionCode=ERP&browsePath=2017&isCollapsed=false&leafLevelBrowse=false&isDocumentResults=true&ycord=0″https://www.gpo.gov/fdsys/browse/collection.action?collectionCode=ERP&browsePath=2017&isCollapsed=false&leafLevelBrowse=false&isDocumentResults=true&ycord=0 the home page of the Economic Report of the President. Scroll down and download individual tables as Excel Find unemployment data (Table B12.Civilian unemployment rate) for each year 2000 to present. Use four labor force groups: males, and females, in each case 16 to 19 years of age, versus 20 years of age or over. Present the result in your project as a table. Create one or more charts. Use the Economic Report of the President (Table B13.Unemployment by duration and reason) to find data on the duration of unemployment for each year 2000 to present. Present the result in your project as a table. Create one or more charts. Write a report (1 – 2 pages double-spaced) about the results you received. In this paper consider, but do not be limited to the following: Which years had the highest and lowest unemployment rates? How do the rates compare among these groups? Compare the distribution of unemployment by duration over these years. Which years had the highest and lowest unemployment duration? What relationship, if any, do you find? Demographic studies show that the proportion of teenagers and minorities in the U.S. population is likely to increase in the near future. In your opinion, what implications, if any, will this trend have on the natural rate of unemployment. Please analyze and discuss the significance of the data that you received for this Data exercise. Reflect on what you have learned from this exercise.
Hide

Part 1 Generate a table with 2 columns; one for TRANSCRIPTION and one for TRANSLATION. Under each column, you should have 3 rows: DEFINITION, LOCATION, STEPS. Fill out the table and when listing the STEPS for both transcription and translation, make sure to list 2 events under each. Make sure to list the functions of mRNA, tRNA and rRNA within the description of the STEPS for TRANSLATION Part 2: Using the codon table below, convert the following strand of DNA into a polypeptide strand. 5′ – GGGCATTACACGTTACCCCAAATTGGA 3′ Please show both the transcription and translation steps. Cleary indicate the START codon and STOP codon. Write down the final amino-acid sequence generated by this DNA strand. Part 3: Explain the differences in management roles between mRNA, rRNA and tRNA. What are their specific duties and responsibilities within translation, make sure to mention within which step(s) each RNA molecule is most effective. Which RNA plays the most essential role in transportation during translation? This assignment is to be completed through the use of Microsoft excel and/or word, with a 2 page limit.